View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_48 (Length: 210)
Name: NF10745_low_48
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 72 - 193
Target Start/End: Complemental strand, 26642968 - 26642847
Alignment:
| Q |
72 |
ttatgattttagtaaatgttgttacattgaaggttgagattcattactatggtagacttgcagcaaaacgaggatggcgttttgattcaacctatgacca |
171 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26642968 |
ttatgattttagtaaatgtttttatattgaaggttgagattcattactatggtagacttgcagcaaaacaaggatggcgttttgattcaacctatgacca |
26642869 |
T |
 |
| Q |
172 |
caaagatgagaatggtgatcct |
193 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26642868 |
caaagatgagaatggtgatcct |
26642847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University