View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10746_low_2 (Length: 279)
Name: NF10746_low_2
Description: NF10746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10746_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 15 - 264
Target Start/End: Complemental strand, 44677184 - 44676919
Alignment:
| Q |
15 |
aatataatatgatatgtttttgtcgaagtggtttaaagtaacc--caaccaaaacatattaatgctgtcatgtcaaacaaatggtttcttctgcaatcta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44677184 |
aatataatatgatatgtttttgtcgaagtggtttaaagtaatgttcaacctcttg-tattaatgctgtcatgtcaaacaaatggtttcttctgcaatcta |
44677086 |
T |
 |
| Q |
113 |
aatgcgccttgccactgtcaccaaaaagaaaaatagaagaagctcttttgtcata---------------gtattttgcttcaatttgaacaaattacaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44677085 |
aatgcgccttgccactgtcaccaaaaagaaaaatagaagaagctcttttgtcatagtgttttctccttgtgtattttgcttcaatttgaacaaattacaa |
44676986 |
T |
 |
| Q |
198 |
aattcccataaataaaggaatagactagaaaatgaaatgacatagttttttggcaattggtaatttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44676985 |
aattcccataaataaaggaatagactagaaaatgaaatgacaaagttttttggcaattggtaatttc |
44676919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University