View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10746_low_3 (Length: 250)
Name: NF10746_low_3
Description: NF10746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10746_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 39849073 - 39849311
Alignment:
| Q |
11 |
caaaggtgacagactcagactcttaggagcccgagccagagccagagcctcagcatgtcccgagtctaagtttgtgcacgaggcacaacaggtggaggtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849073 |
caaaggtgacagactcagactcttaggagccagagccagagccagagcctcagcatgtcccgagtctaagtttgtgcacgaggcacaacaggtggaggtt |
39849172 |
T |
 |
| Q |
111 |
cagcaggagtaggcgtcgacacagcctcggaagttacatcctagtggtccgtttgacatgctaaagcttttaaccttgataattcatgtatgcctgcctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849173 |
cagcaggagtaggcgtcgacacagcctcggaagttacatcctagtggtccgtttgacatgttaaagcttttaaccttgataattcatgtatgcctgcctg |
39849272 |
T |
 |
| Q |
211 |
tatgataagggtttactctcaccactctagcataaaatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39849273 |
tatgataagggtttactctcaccactctaccataaaatc |
39849311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University