View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10746_low_5 (Length: 249)
Name: NF10746_low_5
Description: NF10746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10746_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 32184370 - 32184508
Alignment:
| Q |
17 |
agcaaaggaataacatattttcagtaaatggtcaagagttcgattctaaatctttcatgtggagaaaatccagttgagatggaagcactcgcctgccttg |
116 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32184370 |
agcaaaggaataacatattttaagtagatggtcaagagttcgattctaaatccttcatgtggagaaaatccagttgagatggaagcactc----gccttg |
32184465 |
T |
|
| Q |
117 |
ttttatgacggataaattttgcaatggaaattagtcggtgtta |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184466 |
ttttatgacggataaattttgcaatggaaattagtcggtgtta |
32184508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University