View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10747_high_7 (Length: 237)
Name: NF10747_high_7
Description: NF10747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10747_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 84 - 160
Target Start/End: Original strand, 5545727 - 5545803
Alignment:
| Q |
84 |
aactttataaatacccaattctatgtccactttgctttttatttattttgtgatatcttcttctagttgaaataagt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5545727 |
aactttataaatacccaattctatgtccactttgctttttatttattttgtgatatcttcttctagttgaaataagt |
5545803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 222
Target Start/End: Original strand, 5545827 - 5545865
Alignment:
| Q |
184 |
catcaagagctagctgaaacatctctcttctgttgtaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5545827 |
catcaagagctagctgaaacatctctcttctgttgtaac |
5545865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University