View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10747_low_7 (Length: 240)
Name: NF10747_low_7
Description: NF10747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10747_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 38124003 - 38123793
Alignment:
| Q |
18 |
tttgcatatagaaaatgagtaaaagagtaataaacagcttacatcaataagctctcctaaaggagcttcatcaccaaaaccctcaacataatcacagtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124003 |
tttgcatatagaaaatgagtaaaagagtaataaacagcttacatcaataagctctcctaaaggagcttcatcaccaaaaccctcaacataatcacagtaa |
38123904 |
T |
 |
| Q |
118 |
ccaagcccagatttaacataattaagctcacacattggttctcccacagtagcatagtattcaattctcgttgcatctgcatccaacgctgttaacccca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38123903 |
ccaagcccagatttaacataattaagctcacacattggttctcccacagtagcatagtattcaattctcgttgcatctgcatccaacgctgttaacccca |
38123804 |
T |
 |
| Q |
218 |
ttacctatgct |
228 |
Q |
| |
|
||||| ||||| |
|
|
| T |
38123803 |
ttacccatgct |
38123793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University