View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10747_low_9 (Length: 237)

Name: NF10747_low_9
Description: NF10747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10747_low_9
NF10747_low_9
[»] chr2 (2 HSPs)
chr2 (84-160)||(5545727-5545803)
chr2 (184-222)||(5545827-5545865)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 84 - 160
Target Start/End: Original strand, 5545727 - 5545803
Alignment:
84 aactttataaatacccaattctatgtccactttgctttttatttattttgtgatatcttcttctagttgaaataagt 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5545727 aactttataaatacccaattctatgtccactttgctttttatttattttgtgatatcttcttctagttgaaataagt 5545803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 222
Target Start/End: Original strand, 5545827 - 5545865
Alignment:
184 catcaagagctagctgaaacatctctcttctgttgtaac 222  Q
    |||||||||||||||||||||||||||||||||||||||    
5545827 catcaagagctagctgaaacatctctcttctgttgtaac 5545865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University