View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10748_low_5 (Length: 356)
Name: NF10748_low_5
Description: NF10748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10748_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 42038163 - 42038496
Alignment:
| Q |
1 |
acaagattctacggttccaactcatggctggatgtgtctcccactcatagaagaagtatgcactgccaagattttaccgagaaacacttccaccatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42038163 |
acaagattctacggttccaactcacggctggatgtgtctcccactcatagaagaagtatgcactgccaagattttaccgagaaacacttccacgatcaaa |
42038262 |
T |
 |
| Q |
101 |
attttgccctatcgatcaaactttgccctatccaacaagaactcaacataaatagatcatcccaacaaagattagatcattgtgagagttccaaatagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038263 |
attttgccctatcgatcaaactttgccctatccaacaagaactcaacataaatagatcatcccaacaaagattagatcattgtgagagttccaaatagtc |
42038362 |
T |
 |
| Q |
201 |
cgctagacaacatgtcatacaagcgtcatgtcaaacaagcgtcaaacataacctaaccatcttactataacccaacccccaaaaagacacaaaagcaacc |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038363 |
cgctagacaacatgtcatacaagcgccatgtcaaacaagcgtcaaacataacctgaccatcttactataacccaacccccaaaaagacacaaaagcaacc |
42038462 |
T |
 |
| Q |
301 |
aagatcctgaagaagaacaaactgccaacccaac |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42038463 |
aagatcctgaagaagaacaaactgccaacccaac |
42038496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University