View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_23 (Length: 371)
Name: NF1074_low_23
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 11 - 179
Target Start/End: Complemental strand, 48225044 - 48224879
Alignment:
| Q |
11 |
cagagaaagatcgtgaatgagtggggttgcaagcatgcatgcatgttaccacagaatttggagccatgtgctttgagtcacacatttcacatcttttgcn |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48225044 |
cagagaaagatagtgaatgagtggggttgcaagcatgcatgcatgttaccacagaatttggagccatgtgc-ttgagtcacacatttcacatcttttgc- |
48224947 |
T |
|
| Q |
111 |
nnnnnnnnnnnaactgtgcacgccgatattggatcactatggcggtgcaccaatactagaagctgagga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48224946 |
-tgtgtgtgtcaactgtgcacgccgatattggatcactatggcggtgcaccaatactagaagctgagga |
48224879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 246 - 323
Target Start/End: Complemental strand, 48224811 - 48224734
Alignment:
| Q |
246 |
attatgaaattatatttaactttcatgtctctttttaagataatttacaagtacgtatcctacaaagcacgaaggaag |
323 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48224811 |
attatgaaattatatttaactttcatctctctttttaagataatttacaagtacgtatcctacaaagcacgaaggaag |
48224734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University