View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_32 (Length: 312)
Name: NF1074_low_32
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_32 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 101 - 312
Target Start/End: Complemental strand, 5440884 - 5440674
Alignment:
| Q |
101 |
gaggattttcaacaatctttatgaattgttcttcctgtctgtctaaaagtgatgaaaatatgtagttttatgaaatgttttaattttcacattttatgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5440884 |
gaggattttcaacaatctttatgaattattcttcctgtctgtctaaaagtgatgaaaatatgtagttttatgaaatgttttaattttcacattttatgct |
5440785 |
T |
 |
| Q |
201 |
caactagaattttggttacacatacttcaaggaatgannnnnnnatcatgtaacatggtttgtttgagtcaataaaattttgttgtagatatccctctat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5440784 |
caactagaattttggttacacatacttcaaggaatga-ttttttatcatgtaacatggtttgtttgagtcaataaaattttgttgtagatatccctctat |
5440686 |
T |
 |
| Q |
301 |
tgtaccaaataa |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5440685 |
tgtaccaaataa |
5440674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University