View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_39 (Length: 264)
Name: NF1074_low_39
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 23006752 - 23006688
Alignment:
| Q |
33 |
aacatgtcaacgcagacgtcatgtttgtgtttcaggtcaaatcttgatctccctcctctcttcaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23006752 |
aacatgtcaacgcagacgtcatgtttgtctttcaggtcaaatcttgatctccctcatctcttcaa |
23006688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 33 - 87
Target Start/End: Complemental strand, 30575020 - 30574966
Alignment:
| Q |
33 |
aacatgtcaacgcagacgtcatgtttgtgtttcaggtcaaatcttgatctccctc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30575020 |
aacatgtcaacgcagacgtcatgtttgtctttcatgtcaaatcttgatctccctc |
30574966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 140
Target Start/End: Original strand, 4356962 - 4357001
Alignment:
| Q |
101 |
tattagcctttgttaccataacactccaaaatatatgctt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4356962 |
tattagcctttgttaccataacactccaaaatatatgctt |
4357001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University