View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_41 (Length: 258)
Name: NF1074_low_41
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 20465669 - 20465722
Alignment:
| Q |
142 |
tgattgctacgtctgagtgtgtgccgatgatttgtcttactgctgtccactcct |
195 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
20465669 |
tgattgctaagtctgagtctgtgcatatgatttgtcttactgctgtccactcct |
20465722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University