View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1074_low_41 (Length: 258)

Name: NF1074_low_41
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1074_low_41
NF1074_low_41
[»] chr4 (1 HSPs)
chr4 (142-195)||(20465669-20465722)


Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 20465669 - 20465722
Alignment:
142 tgattgctacgtctgagtgtgtgccgatgatttgtcttactgctgtccactcct 195  Q
    ||||||||| |||||||| |||||  ||||||||||||||||||||||||||||    
20465669 tgattgctaagtctgagtctgtgcatatgatttgtcttactgctgtccactcct 20465722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University