View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_45 (Length: 252)
Name: NF1074_low_45
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 50516533 - 50516714
Alignment:
| Q |
1 |
caagatgtcatggagggaagaaagaagttgtgaacgtaaacgcctctactaatgtaatggcaactcctcatggacaaaagtaaagtcataatcttagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50516533 |
caagatgtcatggagggaagaaagaagttgtgaacgtaaacgcctctactaatgtaatggcaactcctcatggacaaaagtaaagtcataatcttagcaa |
50516632 |
T |
|
| Q |
101 |
ctagagaggnnnnnnnntgcattggcaaatcaaagaatgtgagagtgtgtgtgaagagtgaacgcactccttgccaattgca |
182 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50516633 |
ctagagaggaaaaaaaatgcattggcaaatcaaagaatgtgagagtgtgtgtgaagagtgaacgcactccttgccaattgca |
50516714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University