View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1074_low_51 (Length: 228)

Name: NF1074_low_51
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1074_low_51
NF1074_low_51
[»] chr1 (1 HSPs)
chr1 (1-206)||(45597146-45597351)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 45597351 - 45597146
Alignment:
1 ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcaatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
45597351 ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcgatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg 45597252  T
101 cgaggttcatagcccacgatgcaagttaggcactagctaactctttgatttcttcactccatattccatattttctcaccaaaacgtctttaacaactat 200  Q
    ||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45597251 cgaggttcatagcccgcgatgcaagttaggcactagctgcctctttgatttcttcactccatattccatattttctcaccaaaacgtctttaacaactat 45597152  T
201 gcccta 206  Q
    ||||||    
45597151 gcccta 45597146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University