View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_6 (Length: 617)
Name: NF1074_low_6
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 4e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 4e-89
Query Start/End: Original strand, 70 - 252
Target Start/End: Complemental strand, 30742443 - 30742261
Alignment:
| Q |
70 |
ccacagacaagaattatgacagtgacaacacaaacaaaaatcataaaaccgaacaacccgagcaaagacaaccatatggaaaggcgatgatcgttttctt |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742443 |
ccacggacaagaattatgacagtgacaacacaaacaaacatcataaaaccgaacaacccgagcaaagacaaccatatggaaaggcgatgatcgttttctt |
30742344 |
T |
|
| Q |
170 |
tgtgctgtgatgggacatggataatttatgataggttgttccatacgttgtagacaataccaagaaagacaacggttgagact |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30742343 |
tgtgctgtggtgggacatggataatttatgataggttgttccatacgttgttgacaataccaagaaagacaacggttgagact |
30742261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University