View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1074_low_9 (Length: 501)
Name: NF1074_low_9
Description: NF1074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1074_low_9 |
 | |
|
| [»] scaffold0565 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0565 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 308 - 492
Target Start/End: Complemental strand, 4925 - 4741
Alignment:
| Q |
308 |
tcagtattactctagtttatttatctttctcaactatatattcatgatttgactctttaattaatatatagctttgtatgcatgcaagtaattgtcttca |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4925 |
tcagtattactctagtttatttatctttctcaactatatattcatgatttgactctttaattaatatatagctttgaatgcatgcaagtaattgtcttca |
4826 |
T |
|
| Q |
408 |
tttactcttgtctaacctttaatggaaatttaacagctgagcaattggggttcaatggttacataccttcgtatgcaacagctag |
492 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4825 |
tttactcttgtctaacctttaatggaaatttaacagctgagcaattggggttcaatggttacataccttcgtatgcatcagctag |
4741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 30 - 189
Target Start/End: Complemental strand, 5204 - 5045
Alignment:
| Q |
30 |
tatttttggagactctttggtggataatggtaacaacaaccaactcacttctattgcaaaagctaattacctaccttatggaattgactttcctggtgga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5204 |
tatttttggagactctttggtggataatggtaacaacaaccaactcacttctattgcaaaagctaattacctaccttatggaattgactttcctggtgga |
5105 |
T |
|
| Q |
130 |
ccaactggaagattttccaacggcaaaactactgttgatgtcattggtaagtgagattgc |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5104 |
ccaactggaagattttcaaacggcaaaaccactgttgatgtcattggtaagtgagattgc |
5045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 9e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 31 - 177
Target Start/End: Original strand, 7612449 - 7612595
Alignment:
| Q |
31 |
atttttggagactctttggtggataatggtaacaacaaccaactcacttctattgcaaaagctaattacctaccttatggaattgactttcctggtggac |
130 |
Q |
| |
|
|||||||| ||||||||||| ||| |||| ||||| ||| | || | |||| | || ||||||||||| || |||||||| ||||||||| |||||| | |
|
|
| T |
7612449 |
atttttggtgactctttggtagatgatggaaacaataacaatcttaattctttggccaaagctaattatcttccttatgggattgactttaatggtggtc |
7612548 |
T |
|
| Q |
131 |
caactggaagattttccaacggcaaaactactgttgatgtcattggt |
177 |
Q |
| |
|
|||||||||| || ||||| || |||||||||||||||||||||||| |
|
|
| T |
7612549 |
caactggaaggttctccaatggaaaaactactgttgatgtcattggt |
7612595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 90 - 180
Target Start/End: Complemental strand, 36363845 - 36363758
Alignment:
| Q |
90 |
agctaattacctaccttatggaattgactttcctggtggaccaactggaagattttccaacggcaaaactactgttgatgtcattggtaag |
180 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| |||||||| |||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
36363845 |
agctgattaccttccttatggaattgacttt---ggtggacctactggaaggttttccaacggaaaaaccactgttgatgcaattggtaag |
36363758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 84 - 152
Target Start/End: Complemental strand, 5573523 - 5573455
Alignment:
| Q |
84 |
tgcaaaagctaattacctaccttatggaattgactttcctggtggaccaactggaagattttccaacgg |
152 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| || ||||| ||||||||| ||||||| |
|
|
| T |
5573523 |
tgcaaaatctaattacaaaccttatggaattgactttccgatgggtccaaccggaagatttaccaacgg |
5573455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University