View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10750_high_1 (Length: 427)
Name: NF10750_high_1
Description: NF10750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10750_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 11 - 412
Target Start/End: Original strand, 5053585 - 5053986
Alignment:
| Q |
11 |
agcagcacagaaaaagcgctcatttcacttgtttgcatcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
5053585 |
agcagcacagaaaaagcgctcatttcacttgttagcatcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaa |
5053684 |
T |
 |
| Q |
111 |
actaatactaccaactatagattatatatagtggttctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5053685 |
actaatactaccaactatagattatatatagtggttctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggtt |
5053784 |
T |
 |
| Q |
211 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttgcggaggcttcaaaatcccttatattaccgtggcaatactgttgcg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053785 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcg |
5053884 |
T |
 |
| Q |
311 |
gagacttcaaaatccttgatactgcagttgcaatagtggttactgatactattggagagacttcaaaatcttttatatcatcgcaattgcgcttgcagaa |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
5053885 |
gagacttcaaaatccttgatactgcagttgcaatagtggttactgatactattggagagacttcaaaatcttttatatggtggcaattgcgcttgcagaa |
5053984 |
T |
 |
| Q |
411 |
aa |
412 |
Q |
| |
|
|| |
|
|
| T |
5053985 |
aa |
5053986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University