View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10750_low_3 (Length: 330)
Name: NF10750_low_3
Description: NF10750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10750_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 21 - 308
Target Start/End: Original strand, 17970753 - 17971044
Alignment:
| Q |
21 |
tttgactaaaattaattgtgcattctaagcgatacgatttgttttctctcttgaaaaaggtggattcgttttttatcttcctccatgttttcggttaaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17970753 |
tttgactaaaattaattgtgcattctaagcgatacgatttgttttctctcttgaaaaaggtggattcgttttttatcttcctccatgttttcggttaaaa |
17970852 |
T |
|
| Q |
121 |
gaatcaattaatggttctctccattaatttcgtttatgaattcaactctagagactagaagtaagtaagtgagnnnnnnnnngtttgaaccacaactct- |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
17970853 |
gaatcaattaatggttctctccattaatttcgtttacgaattcaactctagagactagaagtaagtaagtgagttttttggtgtttgaaccacaacttta |
17970952 |
T |
|
| Q |
220 |
-----tgcaaaatttcacatgataaggggtgattaatgcaccactttataagtttttcaaaatcttattaataaggttttttcttgaaaattga |
308 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17970953 |
atctgtgcaaaaatgcacatgataaggggtgattaatgcaccactt--cgagtttttcaaaatcttattaataaggttttttcttgaaaattga |
17971044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 286
Target Start/End: Complemental strand, 9456730 - 9456668
Alignment:
| Q |
224 |
aaatttcacatgataaggggtgattaatgcaccactttataagtttttcaaaatcttattaat |
286 |
Q |
| |
|
||||| |||| ||||| |||| |||||||||||| ||||| | |||||| ||||||||||||| |
|
|
| T |
9456730 |
aaattgcacaagataaagggttattaatgcaccattttatgaatttttccaaatcttattaat |
9456668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 262
Target Start/End: Original strand, 45195983 - 45196025
Alignment:
| Q |
220 |
tgcaaaatttcacatgataaggggtgattaatgcaccacttta |
262 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
45195983 |
tgcaaaattgtacatgataaagggtgattaatgcaccacttta |
45196025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 262
Target Start/End: Original strand, 42068978 - 42069020
Alignment:
| Q |
220 |
tgcaaaatttcacatgataaggggtgattaatgcaccacttta |
262 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
42068978 |
tgcaagattgcacaggataaggggtgattaatgcaccacttta |
42069020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University