View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_high_19 (Length: 239)
Name: NF10751_high_19
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 113
Target Start/End: Complemental strand, 56226657 - 56226561
Alignment:
| Q |
17 |
atgaatcattcatttgagacaaaacgaagggtattatttacatctaaaggcaaaatgataggcacttgtggggtttattgtgtgaactcaggagtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56226657 |
atgaatcattcatttgagacaaaacgaaggatattatttacatctaaaggcaaaatgataggcacttgtggggtttattgtgtgaactcaggagtaa |
56226561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 11938027 - 11937930
Alignment:
| Q |
19 |
gaatcattcatttgagacaaaacgaagggtattatttacatctaaaggcaaaatgataggcacttgtggggtttattgtgtgaactcaggagtaaata |
116 |
Q |
| |
|
|||| ||||||| |||| |||| ||| | ||| ||||| |||| ||||||||||||| || |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
11938027 |
gaattattcattcgagagaaaatgaaagatatgatttagatctgaaggcaaaatgattggaacttgtggggtttattttgtgaactgaggagtaaata |
11937930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 24 - 116
Target Start/End: Original strand, 8554837 - 8554929
Alignment:
| Q |
24 |
attcatttgagacaaaacgaagggtattatttacatctaaaggcaaaatgataggcacttgtggggtttattgtgtgaactcaggagtaaata |
116 |
Q |
| |
|
||||||| |||| |||| ||| | ||| ||||| |||| ||||||||||||| || |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8554837 |
attcattcgagagaaaatgaaagatatgatttagatctgaaggcaaaatgattggaacttgtggggtttattttgtgaactgaggagtaaata |
8554929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 7806741 - 7806649
Alignment:
| Q |
24 |
attcatttgagacaaaacgaagggtattatttacatctaaaggcaaaatgataggcacttgtggggtttattgtgtgaactcaggagtaaata |
116 |
Q |
| |
|
||||||| |||| |||| ||| | ||| ||||| |||| ||||||||||||| || |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
7806741 |
attcattcgagagaaaatgaaagatatgatttagatctgaaggcaaaatgattggaacttgtggggtttattttgtgaactgaggagtaaata |
7806649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University