View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_high_20 (Length: 238)
Name: NF10751_high_20
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 9385059 - 9384954
Alignment:
| Q |
1 |
caaggaatttggtgcttagcggattatttgatcaactgattaaccatttgatcagatgatcatatgatcataaataactcacaccgataataatgattct |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
9385059 |
caaggaatttggtgcttagcggattctttgatcaactgattaaccatttgatcagatgatcatatgatcataaataactcatatcgataataatgattct |
9384960 |
T |
 |
| Q |
101 |
cttatt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
9384959 |
cttatt |
9384954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 9384887 - 9384842
Alignment:
| Q |
176 |
cagttgtgagtttgtagattaatctataaagagtgtatatggtgttac |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9384887 |
cagttgtgagtttgtagattaatc--taaagagtgtatatggtgttac |
9384842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University