View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_high_6 (Length: 300)
Name: NF10751_high_6
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_high_6 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 40465845 - 40465573
Alignment:
| Q |
1 |
gggttgatttctcaagctgtttatgatggtggtcgacatgtaattgggtaagccaagagcttcatattcttatttttaaagctatttgtttgtatttacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
40465845 |
gggttgatttctcaagctgtttatgatggtggtcgacatgtaattgggtaagc-aagagcttcatcttctt---tttaaagctatttgtttgtatttacg |
40465750 |
T |
|
| Q |
101 |
gaaaccctagcataatcacattgtgtcaccgtgatattgtcaaattttttcgtgattctaaaatgcacgactgctatatatttagttaaattcaactaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40465749 |
gaaaccctagcataatcacattgtgtcaccgtgatattgtcaaat-ttttcgtgattctaaaatgcacgactgctatatatttagttaaactcaactaac |
40465651 |
T |
|
| Q |
201 |
nnnnnnnnnnnnnnnnnnnncagagtgattcccaaaacactaatgccaagagaggtaaagttatgcaactttggaagc |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465650 |
ttttgttttgtttttgttttcagagtgattccgaaaacactaatgccaagagaggtaaagttatgcaactttggaagc |
40465573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 21625357 - 21625405
Alignment:
| Q |
1 |
gggttgatttctcaagctgtttatgatggtggtcgacatgtaattgggt |
49 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
21625357 |
gggttggtttctcaagctgtttctgatggaggtcgacatgtgattgggt |
21625405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 77277 - 77319
Alignment:
| Q |
8 |
tttctcaagctgtttatgatggtggtcgacatgtaattgggta |
50 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
77277 |
tttctcaagctgttcatgatggtggtcgccatgtcattgggta |
77319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 40889007 - 40888965
Alignment:
| Q |
8 |
tttctcaagctgtttatgatggtggtcgacatgtaattgggta |
50 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
40889007 |
tttctcaagctgttcatgatggtggtcgccatgtcattgggta |
40888965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University