View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_high_7 (Length: 283)
Name: NF10751_high_7
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 43 - 268
Target Start/End: Original strand, 5688593 - 5688818
Alignment:
| Q |
43 |
caaaataatgtttataagaaattttgtgagagtctttataatattttcnnnnnnntaaataaggtcttacctttttaatcaacaactcatacatagggcc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5688593 |
caaaataatgtttataagaaattttgtgagagtctttataatattttcaaaaaaataaataaggtcttacctttttaatcaacaactcatacatagggcc |
5688692 |
T |
 |
| Q |
143 |
gacttcatatagtatttttatagctcatacttgaaagaactttttggcctaacgcgataaaggttgttaaggccgatctgtttaaggttagataacccat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
5688693 |
gacttcatatagtatttttatagctcgtacttgaaagaactttttggcctaaagcgataaaggttgttagggccgatctctttaaggttagataacccat |
5688792 |
T |
 |
| Q |
243 |
tttgagagctctacacatattctcat |
268 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
5688793 |
tttgagagctctacacataatctcat |
5688818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University