View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_high_9 (Length: 271)
Name: NF10751_high_9
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 25355116 - 25354873
Alignment:
| Q |
17 |
gtaacattatgtgtattagaattcaaacgcggatggttagtcctgcatcgattttaactttttcgcattttctatagctaaattgatgcattatttactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25355116 |
gtaacattatgtgtattagaattcaaacgcggatggttagtcctgcatcgattttaactttttctcattttctatagctaaattgatgcattatttactt |
25355017 |
T |
 |
| Q |
117 |
tacaggcagatcaccttaggcaacaaactctgttatacatgtcacgcatcttatcgattggtcaagctgctcaaggcttgctggctatgggggaatactt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25355016 |
tacaggcagatcaccttaggcaacaaactctgttatacatgtcacgcatcttatcgattggtcaagctgctcaaggcttgctggctatgggggaatactt |
25354917 |
T |
 |
| Q |
217 |
tcatcgtcttcgcactcttagttcattgtggactgctcgttcat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25354916 |
tcatcgtcttcgcactcttagttcattgtggactgctcgttcat |
25354873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 117 - 260
Target Start/End: Complemental strand, 25349002 - 25348859
Alignment:
| Q |
117 |
tacaggcagatcaccttaggcaacaaactctgttatacatgtcacgcatcttatcgattggtcaagctgctcaaggcttgctggctatgggggaatactt |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | |||||||| || ||||| | |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25349002 |
tacaggcagatcacctcaggcaacaaactctggtgtacatgtctcgtatcttgacaattgtgcaagctgctcaaggcttgctggctatgggggattactt |
25348903 |
T |
 |
| Q |
217 |
tcatcgtcttcgcactcttagttcattgtggactgctcgttcat |
260 |
Q |
| |
|
||| |||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
25348902 |
tcaccgtcttcgcacttgtagttctttgtggacttctcgttcat |
25348859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 117 - 219
Target Start/End: Complemental strand, 25347456 - 25347354
Alignment:
| Q |
117 |
tacaggcagatcaccttaggcaacaaactctgttatacatgtcacgcatcttatcgattggtcaagctgctcaaggcttgctggctatgggggaatactt |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | | ||||| | |||| || | ||| | ||||| |||||||| || |||||||||||| |||||| |
|
|
| T |
25347456 |
tacaggcagatcaccttaggcaagaaactctggtgcagatgtctcacatcctaacaattaggcaagcagctcaaggttttttggctatggggggatactt |
25347357 |
T |
 |
| Q |
217 |
tca |
219 |
Q |
| |
|
||| |
|
|
| T |
25347356 |
tca |
25347354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University