View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_17 (Length: 251)
Name: NF10751_low_17
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 27 - 251
Target Start/End: Complemental strand, 44256994 - 44256770
Alignment:
| Q |
27 |
gaatatgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccac |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44256994 |
gaatatgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccac |
44256895 |
T |
|
| Q |
127 |
tcttcttaccccgaatccgtttcctatgaacgtctcgagttcatcggcgatgccgtattaggccacgctatgagcaaccatctcttcctcgtttacacta |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44256894 |
tcttcttaccccgaatccgtttcctatgaacgtctcgagttcatcggcgatgccgtattaggccacgctatcagcaaccatctcttcctcgtttacacta |
44256795 |
T |
|
| Q |
227 |
acgttgaccaacgtcaactctctct |
251 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44256794 |
acgttgaccaacgtcaactctctct |
44256770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 31 - 168
Target Start/End: Complemental strand, 20473568 - 20473431
Alignment:
| Q |
31 |
atgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccactctt |
130 |
Q |
| |
|
||||| ||| ||||||||| ||| |||||||||||||||||||||||||| ||||| ||| |||||||| ||||||||||| ||| |||||||| ||| |
|
|
| T |
20473568 |
atgaaaatggagatggaagcttcagttgcagcagtggagaagataatcggctacacattcctcaacaagaagcttctagaagatgctctaacccacactt |
20473469 |
T |
|
| Q |
131 |
cttaccccgaatccgtttcctatgaacgtctcgagttc |
168 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
20473468 |
cttaccccgaatctgtttcctacgaacgtctcgagttc |
20473431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 168
Target Start/End: Original strand, 20474954 - 20475090
Alignment:
| Q |
31 |
atgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccactctt |
130 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||| |||||||| || ||||| ||| |||||||| ||| ||||||| || ||||| || ||| |
|
|
| T |
20474954 |
atgaagatggagatggaaggttcaattgcagcagtggaaaagataattggctacacattcctcaacaagaagctt-tagaagatgcattaactcatactt |
20475052 |
T |
|
| Q |
131 |
cttaccccgaatccgtttcctatgaacgtctcgagttc |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20475053 |
cttaccccgaatccgtttcctacgaacgtctcgagttc |
20475090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University