View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10751_low_20 (Length: 248)

Name: NF10751_low_20
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10751_low_20
NF10751_low_20
[»] chr1 (1 HSPs)
chr1 (16-248)||(8293681-8293913)


Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 8293913 - 8293681
Alignment:
16 caatatgatgtggaagggatattcatattacacacataaaactaatagcagtaactcataactatataaaaacaacagaaacgtgtacattgcagaaact 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8293913 caatatgatgtggaagggatattcatattacacacataaaactaatagcagtaactcataactatataaaaacaacagaaacgtgtacattgcagaaact 8293814  T
116 gataatcaatttaatcgtcacgagagaaaacaatactaacctaactattaacatactaatattctacatttgttattnnnnnnntagcacctaaaccaga 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
8293813 gataatcaatttaatcgtcacgagagaaaacaatactaacctaactattaacatactaatattctacatttgttattaaaaaaatagcacctaaaccaga 8293714  T
216 gatgcaattaattatatggagatcaaatgcaca 248  Q
    |||||||||||||||||||||||||||||||||    
8293713 gatgcaattaattatatggagatcaaatgcaca 8293681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University