View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_24 (Length: 242)
Name: NF10751_low_24
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 23332786 - 23332595
Alignment:
| Q |
1 |
tctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332786 |
tctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaacta |
23332687 |
T |
 |
| Q |
101 |
tcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332686 |
tcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 229
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
187 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
229 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 229
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
187 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
229 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University