View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_29 (Length: 239)
Name: NF10751_low_29
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44256735 - 44256513
Alignment:
| Q |
1 |
gctcgtgccgccgtgagtaattgtctccaccgttacattcgtctcaaaactcattctcttgctgaacatattagagagtttgctgccgcggttgagcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44256735 |
gctcgtgccgccgtgagtaattgtctccaccgttacattcgtctcaaaactcattctcttgctgaacatattagagagtttgctgccgcggttgagcaag |
44256636 |
T |
|
| Q |
101 |
agaagggtcgtgctattgttttgtatggtggagcagttaaagcgccgaagattcttgctgatgttgttgagtctgttgctgctgctgtttatgttgatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44256635 |
agaagggtcgtgctattgttttgtatggtggagcagttaaagcgccgaaggttcttgctgatgttgttgagtctgttgctgctgctgtttatgttgatct |
44256536 |
T |
|
| Q |
201 |
tgattttgatcttaagaaattat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44256535 |
tgattttgatcttaagaaattat |
44256513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 70 - 223
Target Start/End: Complemental strand, 20473244 - 20473091
Alignment:
| Q |
70 |
attagagagtttgctgccgcggttgagcaagagaagggtcgtgctattgttttgtatggtggagcagttaaagcgccgaagattcttgctgatgttgttg |
169 |
Q |
| |
|
||||| |||||||||| |||||||| | ||||| | | ||||| |||||||||||||||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
20473244 |
attagtgagtttgctgatgcggttgaacgtgagaaagattgtgctgttgttttgtatggtggttcggttaaagccccgaagattcttgctgatgttgttg |
20473145 |
T |
|
| Q |
170 |
agtctgttgctgctgctgtttatgttgatcttgattttgatcttaagaaattat |
223 |
Q |
| |
|
| ||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20473144 |
aatctattgctgctgctgtttatgttgatgttgattttgatcttaagaaattat |
20473091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University