View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_35 (Length: 229)
Name: NF10751_low_35
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 40466248 - 40466070
Alignment:
| Q |
1 |
agagagatggaaatgaaggtatcaaagtttaagagaatttgtgtgttttgtggtagtagccctggtaacaaaactagctataaggatgctgctattgaac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466248 |
agagagatagaaatgaaggtatcaaagtttaagagaatttgtgtgttttgtggtagtagccctggtaacaaaactagctataaggatgctgctattgaac |
40466149 |
T |
 |
| Q |
101 |
ttggaaaagaattggtaattattactacttttgaannnnnnnnncattttccttattttatcatcatgaataatacaata |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466148 |
ttggaaaagaattggtaattattactacttttgaa-ttttttttcattttccttattttatcatcatgaataatacaata |
40466070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 119
Target Start/End: Original strand, 21624013 - 21624111
Alignment:
| Q |
21 |
atcaaagtttaagagaatttgtgtgttttgtggtagtagccctggtaacaaaactagctataaggatgctgctattgaacttggaaaagaattggtaat |
119 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||||||| | ||||||||| |||||||||||||| |||||||| || |||||||| |
|
|
| T |
21624013 |
atcaaagtttaagaggatttgtgttttttgtggtagtagtcctggtaacaagagtagctataaagatgctgctattgagcttggaaatgagttggtaat |
21624111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 22 - 117
Target Start/End: Complemental strand, 28272022 - 28271927
Alignment:
| Q |
22 |
tcaaagtttaagagaatttgtgtgttttgtggtagtagccctggtaacaaaactagctataaggatgctgctattgaacttggaaaagaattggta |
117 |
Q |
| |
|
|||||||| ||||| ||||||| |||||||| ||||| ||||| || |||| ||| ||| | |||||||| |||||||||||||| ||||||||| |
|
|
| T |
28272022 |
tcaaagttcaagagggtttgtgtcttttgtggaagtagtcctggcaagaaaagtagttatcaagatgctgccattgaacttggaaatgaattggta |
28271927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University