View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_7 (Length: 340)
Name: NF10751_low_7
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 19 - 166
Target Start/End: Complemental strand, 52035779 - 52035632
Alignment:
| Q |
19 |
atcatagctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaatttt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035779 |
atcatcgctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaatttt |
52035680 |
T |
|
| Q |
119 |
agctactttatttatttcattctctaaaaaatgacacttttttaaaaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52035679 |
agctactttatttatttcattctctaaaaaatgacacttttgtaaaaa |
52035632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 196 - 247
Target Start/End: Complemental strand, 52035641 - 52035590
Alignment:
| Q |
196 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035641 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
52035590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 273 - 323
Target Start/End: Complemental strand, 52035589 - 52035539
Alignment:
| Q |
273 |
aatgaaccactttattctctctgaccaatttcaacataagactgcctcaat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52035589 |
aatgaaccactttattgtctctgaccaatttcaacataagactgcctcaat |
52035539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University