View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10751_low_8 (Length: 314)
Name: NF10751_low_8
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10751_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 274
Target Start/End: Complemental strand, 23629612 - 23629354
Alignment:
| Q |
20 |
ttaacccatgacctctgagacaccggttagcaggatccgtatgttatatgatttatgcaattaataagaatttttgcatccgtttctggaacaaattgtc |
119 |
Q |
| |
|
|||||||||| | ||||||||| |||||| ||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23629612 |
ttaacccatgccttctgagacatcggttaacaggacccttatgttatatgctttatgcaattaataagaatttttgcatccgtttctggaacaaattgtc |
23629513 |
T |
 |
| Q |
120 |
attgtagtagggcgcattatgttcnnnnnnnn----ccttcaatatgtcactctcgtgcttaatatggacaaaatatactgtttatagacagtatggggc |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23629512 |
attgtagtagggcgcattatgtttttttttttttttccttcaatatgtcactctcgtgcttaatatggacaaaatatactgtttatagacagtatggggc |
23629413 |
T |
 |
| Q |
216 |
taggattgttgatgtctcacgctgtaaagaataaagacgagtgtatatttgggtggcca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23629412 |
taggattgttgatgtctcacgctgtaaagaataaagacaagtgtatatttgggtggcca |
23629354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University