View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10752_low_3 (Length: 242)

Name: NF10752_low_3
Description: NF10752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10752_low_3
NF10752_low_3
[»] chr1 (2 HSPs)
chr1 (140-227)||(36199498-36199585)
chr1 (154-222)||(47006352-47006420)
[»] chr7 (1 HSPs)
chr7 (147-223)||(47354807-47354883)
[»] chr3 (1 HSPs)
chr3 (155-222)||(34451485-34451552)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 140 - 227
Target Start/End: Original strand, 36199498 - 36199585
Alignment:
140 gttcttgattgattcagatatagagcatttgatgagtatcaaggaattgaagttgcttggaatcaggtcaagctgtatgatttcttac 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36199498 gttcttgattgattcagatatagagcatttgatgagtatcaaggaattgaagttgcttggaatcaggtcaagctgtatgatttcttac 36199585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 222
Target Start/End: Complemental strand, 47006420 - 47006352
Alignment:
154 cagatatagagcatttgatgagtatcaaggaattgaagttgcttggaatcaggtcaagctgtatgattt 222  Q
    ||||| ||||||||||||||||||| ||||||| ||||| || |||||||| || ||||| ||||||||    
47006420 cagatttagagcatttgatgagtatgaaggaatagaagtagcatggaatcaagtaaagctttatgattt 47006352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 47354883 - 47354807
Alignment:
147 attgattcagatatagagcatttgatgagtatcaaggaattgaagttgcttggaatcaggtcaagctgtatgatttc 223  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||  |||| || |||||||||    
47354883 attgatgcagatatagagcatttgatgagtatcaagggattgaagttgcttggaatcaaatcaaactatatgatttc 47354807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 34451485 - 34451552
Alignment:
155 agatatagagcatttgatgagtatcaaggaattgaagttgcttggaatcaggtcaagctgtatgattt 222  Q
    ||||||||||| ||||||||||   ||||||||||||| |||||||||||||| ||| ||| ||||||    
34451485 agatatagagcttttgatgagttagaaggaattgaagtggcttggaatcaggttaaggtgtctgattt 34451552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University