View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10753_high_2 (Length: 279)
Name: NF10753_high_2
Description: NF10753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10753_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 169 - 264
Target Start/End: Complemental strand, 34027014 - 34026919
Alignment:
| Q |
169 |
aattctaggatgagggatcaattaaattcctcaccggtggaccacttaatttgagcgttagatcaaagtaagactactagatctgatagtcattat |
264 |
Q |
| |
|
|||||||| |||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34027014 |
aattctagagtgagagatcaattaagtccctcaccggtggaccacttaatttgagcgttagatcaaagtaagactacgagatctgatagttattat |
34026919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 4060093 - 4060050
Alignment:
| Q |
170 |
attctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
4060093 |
attctaggatgagggctcaattaaatccgtcaccggtggaccac |
4060050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 12449360 - 12449312
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
|||| ||| |||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
12449360 |
ggtggattttagggtgagggatcaattaagtccctcaccggtggaccac |
12449312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 81
Target Start/End: Original strand, 53694731 - 53694800
Alignment:
| Q |
12 |
aaaggaagaggaacgattatggtttatggaacnnnnnnnnngtctctagtaatactcaaatcgagtttac |
81 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53694731 |
aaaggaagaggaatgattatggtttatggaacaaaaaaaaagtctctagtaatactcaaatcgagtttac |
53694800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 54308458 - 54308519
Alignment:
| Q |
170 |
attctaggatgagggatcaattaaattcctcaccggtggaccacttaatttgagcgttagat |
231 |
Q |
| |
|
|||||||| |||||| |||||||| | ||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
54308458 |
attctagggtgagggttcaattaagtccctcaccggtgaaccacttattttgaccgttagat |
54308519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 3584005 - 3584056
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactta |
216 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
3584005 |
ggtggattctagggtgagggagcaattaaatccctcaccggtgtaccactta |
3584056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 55375 - 55325
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||| | |||||||| |
|
|
| T |
55375 |
ggtgaattctaggatgagggttcaattaagtccctcaccgatagaccactt |
55325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 231
Target Start/End: Complemental strand, 18745418 - 18745352
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccacttaatttgagcgttagat |
231 |
Q |
| |
|
||||||||||||| |||||| ||||| || | ||||||||||| |||||| ||||||| | |||||| |
|
|
| T |
18745418 |
ggtgaattctagggtgagggttcaatcaagtccctcaccggtgcaccactgaatttgaccattagat |
18745352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 47571987 - 47571945
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtg |
207 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
47571987 |
ggtgaattctagggtgagggatcaattaagtccctcaccggtg |
47571945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 18744622 - 18744686
Alignment:
| Q |
167 |
tgaattctaggatgagggatcaattaaattcctcaccggtggaccacttaatttgagcgttagat |
231 |
Q |
| |
|
|||||||||||||||||| | ||| || | ||||||||||| |||||| ||||||| | |||||| |
|
|
| T |
18744622 |
tgaattctaggatgagggtttaatcaagtccctcaccggtgcaccactaaatttgaccattagat |
18744686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 53344017 - 53344061
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtgga |
209 |
Q |
| |
|
|||| ||||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
53344017 |
ggtggattctaggatgagggatcaatcaagtccctcaccggtgga |
53344061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 26847769 - 26847720
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccact |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
26847769 |
ggtggattctaggatgagggatcaattaagttcctcaccggtgaaccact |
26847720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 35399991 - 35399944
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
35399991 |
ggtggattctaggatgagggatcaatcaaatccctcaccggtggacca |
35399944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 22633016 - 22632969
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| |||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
22633016 |
ggtggattctagggtgagggatcaattaagtccctcaccggtggacca |
22632969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 202577 - 202619
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtg |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
202577 |
ggtgaattctaggatgagggttcaattaagtccctcaccggtg |
202619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 317414 - 317456
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtg |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
317414 |
ggtgaattctaggatgagggttcaattaagtccctcaccggtg |
317456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 19220913 - 19220963
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||| | | |||||||| |||||||| |
|
|
| T |
19220913 |
ggtgaattctaggatgagggttcaattaagtccgtcaccggtagaccactt |
19220963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 22632327 - 22632369
Alignment:
| Q |
170 |
attctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
22632327 |
attctagggtgagggatcaattaagtccctcaccggtggacca |
22632369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 29387424 - 29387473
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccact |
214 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
29387424 |
ggtgaattctaggatgagggagctattaagttcctcaccggtggaccact |
29387473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 20606969 - 20606920
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccact |
214 |
Q |
| |
|
||||||||||||| |||||| |||||||| | ||||||||||| |||||| |
|
|
| T |
20606969 |
ggtgaattctagggtgagggttcaattaagtccctcaccggtgaaccact |
20606920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 3849597 - 3849644
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
3849597 |
ggtggattctaggatgagggatcaatcaaatccctcaccggtggacca |
3849644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 35892351 - 35892300
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactta |
216 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
35892351 |
ggtggattctagggtgagggagcaattaaatccctcaccggtgtaccactta |
35892300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 42818601 - 42818550
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactta |
216 |
Q |
| |
|
||||||||||||| |||||| |||||||| | ||||||||||||| |||||| |
|
|
| T |
42818601 |
ggtgaattctagggtgagggttcaattaagtccctcaccggtggatcactta |
42818550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 34450815 - 34450865
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactt |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
34450815 |
ggtgaattctagggtgagggatcaattaagtccctcaccggtggagcactt |
34450865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 13924793 - 13924841
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
|||| |||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
13924793 |
ggtggattctagggtgagggctcaattaaatccctcaccggtggaccac |
13924841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 47157427 - 47157383
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtgga |
209 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
47157427 |
ggtgaattctagggtgagggttcaattaaatccctcaccggtgga |
47157383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 18363696 - 18363653
Alignment:
| Q |
170 |
attctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
|||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18363696 |
attctagggtgagggttcaattaagttcctcaccggtggaccac |
18363653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 36248399 - 36248446
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
||||||||||| | ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
36248399 |
ggtgaattctaaggtgagggagcaattaaatccctcaccggtggacca |
36248446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 36599232 - 36599275
Alignment:
| Q |
170 |
attctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
|||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
36599232 |
attctagggtgagggttcaattaagttcctcaccggtggaccac |
36599275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 14527624 - 14527575
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccact |
214 |
Q |
| |
|
|||| |||||||| ||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
14527624 |
ggtggattctagggtgagggatcaattaagtccctcaccggtgaaccact |
14527575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 24565573 - 24565620
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| |||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
24565573 |
ggtggattctagggtgagggttcaattaaatccctcaccggtggacca |
24565620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 24606609 - 24606656
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| |||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
24606609 |
ggtggattctagggtgagggttcaattaaatccctcaccggtggacca |
24606656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 35524925 - 35524878
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggacca |
212 |
Q |
| |
|
|||| |||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
35524925 |
ggtggattctagggtgagggatcaattaagtttctcaccggtggacca |
35524878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 33087514 - 33087472
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
33087514 |
ggtgaattctaggatgagggatcaatcaagtccctcaccggtg |
33087472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 39466885 - 39466935
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccactt |
215 |
Q |
| |
|
||||||||||||| |||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
39466885 |
ggtgaattctagggtgagggtccaattaagtccctcaccggtggaccactt |
39466935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 40372208 - 40372163
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggac |
210 |
Q |
| |
|
|||| |||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
40372208 |
ggtggattctagggtgagggttcaattaagttcctcaccggtggac |
40372163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 35524122 - 35524170
Alignment:
| Q |
165 |
ggtgaattctaggatgagggatcaattaaattcctcaccggtggaccac |
213 |
Q |
| |
|
|||| ||||||||||||| | |||||||| | ||||||||||||||||| |
|
|
| T |
35524122 |
ggtggattctaggatgagagttcaattaagtccctcaccggtggaccac |
35524170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University