View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10753_low_6 (Length: 236)
Name: NF10753_low_6
Description: NF10753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10753_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 43142872 - 43142768
Alignment:
| Q |
16 |
tacatcttctcaatcgatcctcttcctgattggcctttggtggatttggagacaccgcaatctcatgtgcctcggtaacgaaactttgtccttaacccag |
115 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43142872 |
tacatcttctcaattgatcctctttctgattggcctttggtggatttggagacaccgcaatctcatgtgcctcggtaacgaaacattgtccttaacccag |
43142773 |
T |
 |
| Q |
116 |
ctgtg |
120 |
Q |
| |
|
||||| |
|
|
| T |
43142772 |
ctgtg |
43142768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 100
Target Start/End: Complemental strand, 3658158 - 3658111
Alignment:
| Q |
53 |
tggtggatttggagacaccgcaatctcatgtgcctcggtaacgaaact |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
3658158 |
tggtggatttggagacaacgcaatctcatgtgtctaggtaatgaaact |
3658111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 100
Target Start/End: Complemental strand, 13026175 - 13026122
Alignment:
| Q |
47 |
ggcctttggtggatttggagacaccgcaatctcatgtgcctcggtaacgaaact |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
13026175 |
ggcctatggtggatttggagacaacgcaatctcatgtgtctaggtaatgaaact |
13026122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 100
Target Start/End: Original strand, 39014134 - 39014181
Alignment:
| Q |
53 |
tggtggatttggagacaccgcaatctcatgtgcctcggtaacgaaact |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
39014134 |
tggtggatttggagacaacgcaatctcatgtgtctaggtaatgaaact |
39014181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 8239718 - 8239684
Alignment:
| Q |
53 |
tggtggatttggagacaccgcaatctcatgtgcct |
87 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8239718 |
tggtggatttggagacaccgcaacctcatgtgcct |
8239684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University