View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10754_high_2 (Length: 279)
Name: NF10754_high_2
Description: NF10754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10754_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 1488935 - 1488831
Alignment:
| Q |
8 |
gagcagagaaaattgacatataccagatcaaaccaaaccttcttttgagttcttaatttatcatttttggataaattgaattgttaataatactaatgat |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488935 |
gagcaaagaaaattgacatataccagatcaaaccaaaccttcttttgagttcttaatttatcatttttggataaattgaattgttaataatactaatgat |
1488836 |
T |
 |
| Q |
108 |
tactt |
112 |
Q |
| |
|
||||| |
|
|
| T |
1488835 |
tactt |
1488831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 197 - 263
Target Start/End: Complemental strand, 1488746 - 1488680
Alignment:
| Q |
197 |
gagcttacatgaaggtctctggtgatgatggaagaaggtgaagaaagtgatgaaatctttgaagaag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488746 |
gagcttacatgaaggtctctggtgatgatggaagaaggtgaagaaagtgatgaaatctttgaagaag |
1488680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University