View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10754_low_3 (Length: 387)
Name: NF10754_low_3
Description: NF10754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10754_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 163 - 314
Target Start/End: Complemental strand, 39387668 - 39387517
Alignment:
| Q |
163 |
gagtgtaccctaaagaatgcatcccaaaccaattccagaggaagcctattccttgcaatgaagagaaaagcaatcttaggcttctgaacttgagaaacaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39387668 |
gagtgtaccctaaagaatgcatcccaaaccaattccaaaggaagcctattccttgcaatgaaaagaaaagcaatcttaggcttctgaacttgagaaacaa |
39387569 |
T |
|
| Q |
263 |
gttgatgttgcaatgaaacaagccccaaaacatgagtataccgcatctgcat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39387568 |
gttgatgttgcaatgaaacaagccccaaaacatgagtataccgcatctgcat |
39387517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 12 - 100
Target Start/End: Complemental strand, 39387819 - 39387731
Alignment:
| Q |
12 |
ataggctttgattaatcattaaagctgaagctaagcactattggtgcactctacagtttctaattaagcctcctactaatcaccaagtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39387819 |
ataggctttgattaatcattaaagctgaagctaagcactattgatgcactctacagtttctaattaagcctcctactaatcaccaagtc |
39387731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University