View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10754_low_4 (Length: 279)

Name: NF10754_low_4
Description: NF10754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10754_low_4
NF10754_low_4
[»] chr6 (2 HSPs)
chr6 (8-112)||(1488831-1488935)
chr6 (197-263)||(1488680-1488746)


Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 1488935 - 1488831
Alignment:
8 gagcagagaaaattgacatataccagatcaaaccaaaccttcttttgagttcttaatttatcatttttggataaattgaattgttaataatactaatgat 107  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1488935 gagcaaagaaaattgacatataccagatcaaaccaaaccttcttttgagttcttaatttatcatttttggataaattgaattgttaataatactaatgat 1488836  T
108 tactt 112  Q
    |||||    
1488835 tactt 1488831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 197 - 263
Target Start/End: Complemental strand, 1488746 - 1488680
Alignment:
197 gagcttacatgaaggtctctggtgatgatggaagaaggtgaagaaagtgatgaaatctttgaagaag 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1488746 gagcttacatgaaggtctctggtgatgatggaagaaggtgaagaaagtgatgaaatctttgaagaag 1488680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University