View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10755_high_6 (Length: 229)
Name: NF10755_high_6
Description: NF10755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10755_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 39482798 - 39482576
Alignment:
| Q |
7 |
gcagggacacatgaaactaggagcataaatgtatgttactaccctcttcctagattaataatagattgagtacacatgtatccatcatcaataaacaaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39482798 |
gcagggacacatgaaactaggagcataaatgtatgttactaccctcttcctagattaataatagattgagtacacatgtatcaatcatcaataaacaaac |
39482699 |
T |
 |
| Q |
107 |
agtggaatgaaagaaacatgactaggagtgttttattagtcgggggcctctggcaggcttgtatcagggtcttggctagataacatcggatgcactcatg |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39482698 |
agtggaatgaaagaaacatgactagtagtgttttattagttgggggcctctggcaggcttgtatcagggtcttggctagataacatcggatgcactcatg |
39482599 |
T |
 |
| Q |
207 |
tattccttgtgtgaagctgatcc |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39482598 |
tattccttgtgtgaagctgatcc |
39482576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University