View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10755_low_3 (Length: 251)
Name: NF10755_low_3
Description: NF10755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10755_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 34776686 - 34776461
Alignment:
| Q |
20 |
ttaatttgttactagttactaccattttatccttattagcaaaagttatgtaacacagacacttcagattgaaggtaatgtatcctacacattttaatgt |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
34776686 |
ttaatttattactagttactaccattttatccttattagcaaaagttatgtagcagagacacttcggattgaaagtaatgtatcctacacattttaatgt |
34776587 |
T |
 |
| Q |
120 |
ctaacattatctcaacatggacacatgttaataaattgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtatccggt |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34776586 |
ctaacattatctcaacacggacacatgttaataaattgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtgtccggt |
34776487 |
T |
 |
| Q |
220 |
gtgtgcagtgtcagtgtctctgcttc |
245 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
34776486 |
gtgtgcagtgtcagtgtctgtgcttc |
34776461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University