View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10755_low_9 (Length: 224)
Name: NF10755_low_9
Description: NF10755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10755_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 40825673 - 40825476
Alignment:
| Q |
18 |
attatatatatcactaattacaaagaagggtggactctaaacttaag----ccacccagcatatcttcctagatccctgcctaccgacgaagattaattt |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825673 |
attatatatatcactaattacaaaaaagggtggactctaaacttaagtaagccacccagcatatcttcctagatccctgcctaccgacgaagattaatta |
40825574 |
T |
|
| Q |
114 |
atttggtaattcaattaattaatatttataaagtttactttatggtgtcacactaatatgttctttttacaaacatgactttcattgtcttcattcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825573 |
atttggtaattcaattaattaatatttataaagtttactttatggtgtcaccctaatatgttctttttacaaacatgactttcattgtcttcattcat |
40825476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University