View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_high_11 (Length: 267)
Name: NF10756_high_11
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 4057320 - 4057176
Alignment:
| Q |
14 |
agagggcagataaatttgctaagaaagcaacaaaatgactcagagaaacaattcaaaactttgaactttttt-aatcactaagagagattatcaattt-a |
111 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4057320 |
agagggaagataaatttgctaagcaagcaataaaatgacttagagaaacaattcaaaactttgaacttttttaaatcactaagagagattatcaatttgt |
4057221 |
T |
|
| Q |
112 |
ttagcgaatcatggcggtttttggtgacctaaggatatacacatt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4057220 |
ttagcgaatcatggcggtttttggtgacctaaggatatacacatt |
4057176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 4056382 - 4056314
Alignment:
| Q |
184 |
tatatcataatataacatgcacctatgattcaccgttcttgaccttctcttctcattttacatataaat |
252 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4056382 |
tatattataatataacgtgcacctatgattcaccgttcttgaccttcttttctcattttacatataaat |
4056314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University