View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10756_high_17 (Length: 240)

Name: NF10756_high_17
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10756_high_17
NF10756_high_17
[»] chr1 (2 HSPs)
chr1 (18-169)||(45168520-45168671)
chr1 (149-240)||(45168399-45168490)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 45168671 - 45168520
Alignment:
18 ttttagggcataaataattgtcttgcattcttcaatgattatttttgaatgagattaactttagattgttggaatagagttcactagagtccctttgagg 117  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45168671 tttttgggtataaataattgtcttgcattcttcaatgattatttttgaatgagattaactttagattgttggaatagagttcactagagtccctttgagg 45168572  T
118 cttattagatacattatttacaaaataatcgttgttgctattggtgatggtg 169  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
45168571 cttattagatacattatttacaaaataatcgttgttgcttttggtgatggtg 45168520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 149 - 240
Target Start/End: Complemental strand, 45168490 - 45168399
Alignment:
149 ttgttgctattggtgatggtggtaatcatttttctagtttacctttttgataaccccttggttttttgccgatttattgaatgcaggttgct 240  Q
    |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
45168490 ttgttgttattggtgatggtggtaatcatttttctagcttacctttttgataaccccttggttttttgccgattaattgaatgcaggttgct 45168399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University