View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_high_17 (Length: 240)
Name: NF10756_high_17
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 45168671 - 45168520
Alignment:
| Q |
18 |
ttttagggcataaataattgtcttgcattcttcaatgattatttttgaatgagattaactttagattgttggaatagagttcactagagtccctttgagg |
117 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45168671 |
tttttgggtataaataattgtcttgcattcttcaatgattatttttgaatgagattaactttagattgttggaatagagttcactagagtccctttgagg |
45168572 |
T |
 |
| Q |
118 |
cttattagatacattatttacaaaataatcgttgttgctattggtgatggtg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45168571 |
cttattagatacattatttacaaaataatcgttgttgcttttggtgatggtg |
45168520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 149 - 240
Target Start/End: Complemental strand, 45168490 - 45168399
Alignment:
| Q |
149 |
ttgttgctattggtgatggtggtaatcatttttctagtttacctttttgataaccccttggttttttgccgatttattgaatgcaggttgct |
240 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45168490 |
ttgttgttattggtgatggtggtaatcatttttctagcttacctttttgataaccccttggttttttgccgattaattgaatgcaggttgct |
45168399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University