View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_high_25 (Length: 203)
Name: NF10756_high_25
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 44546252 - 44546424
Alignment:
| Q |
12 |
agagaagaaccctagaaagagaacatgggatcatgaaaaagatttatatgatttccttcttcttcacaagattaggtaccctaatactcaaaagaaaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44546252 |
agagaagaaccctagaaagagaacatgggatcatgaaaaagatttatatgatttccttcttc---acaagattagggaccctaatactcaaaagaaaaag |
44546348 |
T |
 |
| Q |
112 |
ctctacaaccttc---ttcacaaattttacattaacgatccaaaagccgactcagacttgataaagatcacagatg |
184 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546349 |
ctctacgaccttcttcttcacaaattttacattaacgatccaaaagccgactcagacttgataaagatcacagatg |
44546424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University