View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10756_high_26 (Length: 201)

Name: NF10756_high_26
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10756_high_26
NF10756_high_26
[»] chr3 (1 HSPs)
chr3 (13-182)||(44131198-44131367)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 182
Target Start/End: Original strand, 44131198 - 44131367
Alignment:
13 gagatgaaacactttgatgataacattactgggcgtgtttttgacaactttcaggtatttaatagcacttgaacattcaatactgttgcgtttatggtaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44131198 gagatgaaacactttgatgataacattactgggcgtgtttttgacaactttcaggtatttaatagcacttgaacattcaatactgttgcgtttatggtaa 44131297  T
113 ctttcaccgttgcagagagatattaaattatcaggatttgtcgtataaatgacaaaggcgatatcacgtc 182  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44131298 ctttcaccgttgtagagagatattaaattatcaggatttgtcgtataaatgacaaaggcgatatcacgtc 44131367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University