View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_10 (Length: 305)
Name: NF10756_low_10
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 29474521 - 29474805
Alignment:
| Q |
1 |
agagagagtataatttgtgtgaagagtataacttccagcacaaggaatttagagaaagataaatggcataagatgccttttggatttgtggggtgatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29474521 |
agagagagtataatttgtgtgaagagtataacttccagcacaaggaatttagagaaagataaatggcataagatgccttttggatttgtggggtgatcaa |
29474620 |
T |
|
| Q |
101 |
aattttcaccttattggaaacacccttaggtgaagaatagaatattcataaccacaaaaggcataacaacatgattttcctaacaatatatatgcttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29474621 |
aattttcaccttattggaaacacccttaggtgaagaatagaatattcataaccacaaaaggcataacaacatgattttcctaacaatatatatgcttatt |
29474720 |
T |
|
| Q |
201 |
tatggtctctaaagaacaatatgctcatttannnnnnnncttatcggtttcaagggtatgtattctttggttctcacacgtttgt |
285 |
Q |
| |
|
|| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29474721 |
taaggtctcaaaagaacaatatgctcatttattttttttcttatcggtttcaagggtatgtattctttggttctcacatgtttgt |
29474805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University