View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_12 (Length: 269)
Name: NF10756_low_12
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 32214856 - 32215000
Alignment:
| Q |
18 |
aggtctcttgtgttagggagcatgtcagttatagaaaattgtatgagatttcacttaacaatttcatctttcaagcaaacatcaaaacatattttccttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214856 |
aggtctcttgtgttagggagcatgccagttatagaaaattgtatgagatttcgcttaacaatttcatctttcaagcaaacatcaaaacatattttccttt |
32214955 |
T |
 |
| Q |
118 |
acgattttattttgaatagaatagtcttaaacaaacaagagtaag |
162 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32214956 |
acgattttattttgaatagaatagtattaaacaaacaagagtaag |
32215000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University