View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_24 (Length: 236)
Name: NF10756_low_24
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 49 - 215
Target Start/End: Complemental strand, 4776273 - 4776107
Alignment:
| Q |
49 |
ttctgctcacaacctaaacctgactccacatactgtgatagtaaggaatttcgcagtatacttggtgccttacattacctttcaatcacacgcccggaca |
148 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
4776273 |
ttctgctcacaacctaaacccgactccacatactgtgacagtaaggaatttcgcagtatgcttggtgccttacactacctttcaatcactcgcccagaca |
4776174 |
T |
|
| Q |
149 |
tagcattcccggtgaataaactagcacaacaaatgcaagctcctactgtgacagatatgcaagcctt |
215 |
Q |
| |
|
| ||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776173 |
ttgcatttccagtgaataaactagcataacaaatgcaagctcctactgtgacagatatgcaagcctt |
4776107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 4776254 - 4776302
Alignment:
| Q |
2 |
ggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776254 |
ggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtt |
4776302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University