View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_26 (Length: 226)
Name: NF10756_low_26
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 699650 - 699849
Alignment:
| Q |
12 |
caaagggaagaagtctaaggctgctgcaaaatcaagcggacaggcttatcagtgggagattttgaggagtgttggtatatcagatgaagagatttcaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
699650 |
caaagggaagaagtctaaggctgctgcaaaatcaagcggacaggcttatcagtgggagattttgaggagtgttggtatatcagatgaagagatttcaaag |
699749 |
T |
 |
| Q |
112 |
tttcaggatccttataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699750 |
tttcaggatccttataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttatta |
699849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 23262472 - 23262274
Alignment:
| Q |
13 |
aaagggaagaagtctaaggctgctgcaaaatcaagcggacaggcttatcagtgggagattttgaggagtgttggtatatcagatgaagagatttcaatgt |
112 |
Q |
| |
|
||||||||||| || || | |||||| ||||| | || |||| |||||| ||||||||| ||||||||||||||||||| |||| |||||||| || |
|
|
| T |
23262472 |
aaagggaagaaatcaaaagttgctgcgaaatcgggtgggcaggtttatcaatgggagattatgaggagtgttggtatatctgatgctgagatttcggagt |
23262373 |
T |
 |
| Q |
113 |
ttcaggatccttataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttatta |
211 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| || |||||||| || ||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
23262372 |
ttcaggatccttataagtggttgtcttattttccgccgttggctgtcgatgatcttaaggcttttgggtttggttgtgattggagaaggtcgtttatta |
23262274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University