View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_33 (Length: 201)
Name: NF10756_low_33
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 182
Target Start/End: Original strand, 44131198 - 44131367
Alignment:
| Q |
13 |
gagatgaaacactttgatgataacattactgggcgtgtttttgacaactttcaggtatttaatagcacttgaacattcaatactgttgcgtttatggtaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44131198 |
gagatgaaacactttgatgataacattactgggcgtgtttttgacaactttcaggtatttaatagcacttgaacattcaatactgttgcgtttatggtaa |
44131297 |
T |
|
| Q |
113 |
ctttcaccgttgcagagagatattaaattatcaggatttgtcgtataaatgacaaaggcgatatcacgtc |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44131298 |
ctttcaccgttgtagagagatattaaattatcaggatttgtcgtataaatgacaaaggcgatatcacgtc |
44131367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University