View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10756_low_9 (Length: 311)
Name: NF10756_low_9
Description: NF10756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10756_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 4948247 - 4947971
Alignment:
| Q |
20 |
ggttattggagttgctatcatcatcattattattagtgaagataatagatctcttcacttggactgtggatccagcttttttgttgtcttcagcttgttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4948247 |
ggttattggagttgctatcatcatcattattattagtgaagataatagatctcttcacttggactgtggatccagcttttttgttgtcttcagcttgttc |
4948148 |
T |
 |
| Q |
120 |
ctccagtgtctgcaaacgtgcctgtagttgtttcatgtacttggtagcatctcccaacacagaagctttgtccatctgcacataccataatattgaatac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4948147 |
ctccagtgtctgcaaacgtgcctgtagttgtttcatgtacttggtagcatctcccaacacagaagctttgtccatctgcacataccataatattgaatac |
4948048 |
T |
 |
| Q |
220 |
attaattcaatgcttagtacaatataaatattgcaattgatattcaggtttaacttatctaggttaagcttgcatgt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4948047 |
attaattcaatgcttagtacaatataaatattgcaattgatattcaggtttaacttatctaggttaagcttgcatgt |
4947971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University