View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10757_low_4 (Length: 274)
Name: NF10757_low_4
Description: NF10757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10757_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 259
Target Start/End: Complemental strand, 32726806 - 32726561
Alignment:
| Q |
14 |
agaagtccggcaaaaccgaatatgaaatacgagaccttcggcggccaggtcgatggcgatgctggatcactcgaagctggcgggggataagtagacctca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
32726806 |
agaagtccggcaaaaccgaatatgaaatacgagaccttcggcggctaggtcgatggcgatgctggatcactcgaagttggcgggggataagtaaacctca |
32726707 |
T |
|
| Q |
114 |
ccatcaggtcaacaatgaccccgatgatgacggtcaacaaacaaaaaatgcaaaccttcacggaagacatcactacaaaaggaa-aaaaggataaatcaa |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
32726706 |
ccatcgggtcaacaatgaccccgatgatgacggtcaacaaacaaaaaatgcaaaccttcacggaagacatcactacaaaaggaaaaaaaggataaatc-a |
32726608 |
T |
|
| Q |
213 |
gtgtgcaaaggttgtcatagtaaacatgttttgcatagaataacttg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32726607 |
gtgtgcaaaggttgtcgtagtaaacatgttttgcatagaataacttg |
32726561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University