View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10757_low_4 (Length: 274)

Name: NF10757_low_4
Description: NF10757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10757_low_4
NF10757_low_4
[»] chr4 (1 HSPs)
chr4 (14-259)||(32726561-32726806)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 259
Target Start/End: Complemental strand, 32726806 - 32726561
Alignment:
14 agaagtccggcaaaaccgaatatgaaatacgagaccttcggcggccaggtcgatggcgatgctggatcactcgaagctggcgggggataagtagacctca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
32726806 agaagtccggcaaaaccgaatatgaaatacgagaccttcggcggctaggtcgatggcgatgctggatcactcgaagttggcgggggataagtaaacctca 32726707  T
114 ccatcaggtcaacaatgaccccgatgatgacggtcaacaaacaaaaaatgcaaaccttcacggaagacatcactacaaaaggaa-aaaaggataaatcaa 212  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |    
32726706 ccatcgggtcaacaatgaccccgatgatgacggtcaacaaacaaaaaatgcaaaccttcacggaagacatcactacaaaaggaaaaaaaggataaatc-a 32726608  T
213 gtgtgcaaaggttgtcatagtaaacatgttttgcatagaataacttg 259  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||    
32726607 gtgtgcaaaggttgtcgtagtaaacatgttttgcatagaataacttg 32726561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University